Visit Your Local PBS Station PBS Home PBS Home Programs A-Z TV Schedules Watch Video Donate Shop PBS Search PBS

NOVA Online (see text links below)
Cracking the Code of Life
Explore a Stretch of Code

Select any of the following terms to find out more about it and to reveal its location (highlighted in blue) in the code below.

On/off switch | Start codon | Stop codon | Exons | Introns | Hitchhiking code | Ancient code | Sites of variation | A gene

Exons
A gene's exons are separated by long regions of DNA called introns, which often have no apparent function. When DNA is transcribed into mRNA, the introns are spliced out, and the exons are spliced together to make the final mRNA. Some geneticists believe that it is this splicing step that allows humans to generate more complexity from their 30,000 genes than, say, a fruit fly could from its 10,000 genes; splicing allows the cell to vary which exons are incorporated into mRNA, thereby varying the final amino-acid composition of the protein.

Find exons

Location: chromosome 1: bases 215847819-215860406 (reverse complemented) located in 1q31.1


taaacttcatggcataaccttgccaaagtatactaagaataaccctgaca
caaagctcttttttcagccaacatgccatgaaagaaagaagacaaggggt
gatctccactctctaagtgaaccactaaacccaccaaagaagaaacgagg
gaaatagaaagaggacccttgcctgagataatggatctgtatgtatgagt
agtagaaccctgctcaaagtacaaggaagggaaaaaaaagttagtttatt
tggaattttggacattaagagtctttattgttcattttcttttaactcac
atgaatggcttatcacttcaattaataaatatttcatttcttttcaacat
attcatgaaacaaatctgaaatgaacagtgcaacatgtgaatgtttagaa
cattataaaattaaacacaaaatctgtctggcaatcttcctagcatctta
ggaaaaaagttgacaaaatttcaagcagcagaagggggcagtaaaactca
acagaaagctctggaagatttttaagattcttccttattttcttttcatg
tagattatttcccaacaaatttcagacgctaatagaaattttgtacaaca
gatccatatatttgcctaaaatagacacagaaacattgaatatatgcaaa
catgagagctataagttttacatgatcaaaccttttttttatggtacaca
atagtcacagtacttttccatataaaacaggtttagtggtcttaatttag
tttggcacatttaatacactcccatgaccagcatcccaaatgtacctatc
cgttttattttattgtctcagaattgtcagttatttaataaattatgtaa
cttttttccttatgctcagatttgcacttctttctaaaactctgcccatc
cttaaagtcccagattctccttgaacttttttttttgactttccaagtac
atggaactcttcactctatcctgctatataagtgacagaatttccactat
gggatagatggagttcaattcctttgagtttaaaataatctaaatataat
tattccttatgccctgtttttccctcacttttgtatccaaatctcttttc
agacaacagaacaattaatgtctgataaggaagacaatgatgatgatcac
ttcaaaatgaattcaggattgtaatgtaaaattttagtactctctcacag
tatggattctaacatggcttctaacccaaactaacattagtagctctaac
tataaacttcaaatttcagtagatgcaacctactcctttaaaatgaaaca
gaagattgaaattattaaattatcaaaaagaaaatgatccacgctcttag
ttgaaatttcatgtaagattccatgcaataaataggagtgccataaatgg
aatgatgaaatatgactagaggaggagaaaggcttcctagatgagatgga
attttagtcatccgtgtctcatgaagaatcagatgtgtacactaagcaaa
acagttaaaaaaaaaacctccaagtgagtctcttatttatttttttctta
taagacttctacaaattgaggtacctggtgtagttttatttcaggtttta
tgctgtcattttcctgtaatgctaaggacttaggacataactgaattttc
tattttccacttcttttctggtgtgtgtgtatatatatatgtatatatac
acacacacatatacatatatatattttttagtatctcaccctcacatgct
cctccctgagcactacccatgatagatgttaaacaaaagcaaagatgaaa
ttccaactgtcaaaatctcccttccatctaattaattcctcatccaacta
tgttccaaaacgagaatagaaaattagccccaataagcccaggcaactga
aaagtaaatgctatgttgtactttgatccatggtcacaactcataatctt
ggaaaagtggacagaaaagacaaaagagtgaactttaaaactcgaattta
ttttaccagtatctcctatgaagggctagtaaccaaaataatccacgcat
cagggagagaaatgccttaaggcatacgttttggacatttagcgtccctg
caaattctggccatcgccgcttcctttgtccatcagaaggcaggaaactt
tatattggtgacccgtggagctcacattaactatttacagggtaactgct
taggaccagtattatgaggagaatttacctttcccgcctctctttccaag
aaacaaggagggggtgaaggtacggagaacagtatttcttctgttgaaag
caacttagctacaaagataaattacagctatgtacactgaaggtagctat
ttcattccacaaaataagagttttttaaaaagctatgtatgtatgtgctg
catatagagcagatatacagcctattaagcgtcgtcactaaaacataaaa
catgtcagcctttcttaaccttactcgccccagtctgtcccgacgtgact
tcctcgaccctctaaagacgtacagaccagacacggcggcggcggcggga
gaggggattccctgcgcccccggacctcagggccgctcagattcctggag
aggaagccaagtgtccttctgccctcccccggtatcccatccaaggcgat
cagtccagaactggctctcggaagcgctcgggcaaagactgcgaagaaga
aaagacatctggcggaaacctgtgcgcctggggcggtggaactcggggag
gagagggagggatcagacaggagagtggggactaccccctctgctcccaa
attggggcagcttcctgggtttccgattttctcatttccgtgggtaaaaa
accctgcccccaccgggcttacgcaatttttttaaggggagaggagggaa
aaatttgtggggggtacgaaaaggcggaaagaaacagtcatttcgtcaca
tgggcttggttttcagtcttataaaaaggaaggttctctcggttagcgac
caattgtcatacgacttgcagtgagcgtcaggagcacgtccaggaactcc
tcagcagcgcctccttcagctccacagccagacgccctcagacagcaaag
cctacccccgcgccgcgccctgcccgccgctgcgatgctcgcccgcgccc
tgctgctgtgcgcggtcctggcgctcagccatacag
gtgagtacctggcg
ccgcgcaccggggactccggttccacgcacccgggcagagtttccgctct
gacctcctgggtctatcccagtactccgacttctctccgaatagagaagc
tacgtgacttgggaaagagcttggaccgctagagttcgaaagaactccgt
ggatattccagctttcccacaagcactgatcattatgagccagttactta
accgatctgagacactctcacctcctaaatagggatagatgatactaatt
tgcaggttgtcattatgataagacaggatctgatcaatatatgtgaattg
tttatatttggaacctttttattgagtggaagaagttgttttaaatattc
tagtcagttctttcctgctcccaggaaagcccggattatgttttaagata
agcaaaatgtcttaaaagtaagctgttttactttgaatttttccctaaat
gttgattagtgtactagatccattttaatttggaaagtgaagtgctactt
atttgaacttcttaaaaatgctaattttaacatctaaagagttaactaag
aaaagcttagtaacatgatgtaccaagttgaatatgctgttatccttatt
tagaatagaaaattggtatttctacgttttatccattctaaggcaggtta
aaaaattgtatttccatgactacctatatatttcttgaatttattattgt
aaagttgattcatagtcaaacaattaaatgtttaaattaagattaagaca
ctagagaatgatttatttgctgtcctttaattgcagcaaatccttgctgt
tcccacccatgtcaaaaccgaggtgtatgtatgagtgtgggatttgacca
gtataagtgcgattgtacccggacaggattctatggagaaaactgctcaa
cac
gtaagtttgtcctttggttgcctcattaggagtggggctggatacag
ttatcattgtatagatttgtgtcttataatgagtcccattaatttctccc
tccctttcttcgtcttcttgcagcggaatttttgacaagaataaaattat
ttctgaaacccactccaaacacagtgcactacatacttacccacttcaag
ggattttggaacgttgtgaataacattcccttccttcgaaatgcaattat
gagttatgtgttgacat
gtaagtacaagtgtctttctaaggtttttagcc
ttctcaaagaaaaatatgctttataatactgtaagcctaatctaaaaaca
tatttccaagcttatcaaaaagactttaagatagcttttaagtttgcctt
ccatcttaatcgccaaaaatattgacatttagtcccatccagtttataca
gtctgctcacaactctgtatacctcttctaacctttactgtttggtcagt
ttgtggaggtagcatggtccagctgtttattgaatgcccatgggccacag
aattgttctgaacatgtagcacccattaaaataaatttggatttggatca
gcaagaaaataactttccatgattctaaagtgggtgccatactcagccat
tcctttcataggcctcttggatagtgagcagatggctacctgaaaaatca
atattgccagattataatgtgcagagtatatgtattttattaaagatgta
tttcaagtggccattagactataaagtgtagttgtttaaaaatagatttt
ttttattttggagttacattcaacctcaggtgccactttccacattttac
aataaaaataatggttgatttacttaacaaatgagaataaataaaacatt
tttttctttgaaaatttcagccagatcacatttgattgacagtccaccaa
cttacaatgctgactatggctacaaaagctgggaagccttctctaacctc
tcctattatactagagcccttcctcctgtgcctgatgattgcccgactcc
cttgggtgtcaaag
gtgagtaagaagaatccattagagatgtattaacta
taagacgggctgcattgctgccaaaaaaaaaaattgaccttagactacca
tttatttattaacaaaagcagtttttacttttagcatggttatctatggg
tattttttaaagtatgagtctatataaactattatgtaaaagcaaatgag
cgtcttggtataatgtcttaatattttcaaattatttctttagaaatgaa
ataattctaattaaaatagataaaatcattcagtaagaagttgttccacc
atatcttagaactgttgtttatattatgatcctattcacaattgtaattc
tcatataaatgaagaattcttggtagattgacagtcaccatctcctttct
tgaatacatagatggattcttaccttagctttctcatttttcaggtaaaa
agcagcttcctgattcaaatgagattgtggaaaaattgcttctaagaaga
aagttcatccctgatccccagggctcaaacatgatgtttgcattctttgc
ccagcacttcacgcatcagtttttcaagacagatcataagcgagggccag
ctttcaccaacgggctgggccatggg
gtaagatagagttaatatcttaga
gttagtaaaattataccaaatcatagtcaagggctaacattaaaggagat
atacagatagatagatccaaataacttatccactttttttaaaaagaagt
cttatctataaaaaccttaaaggaattttccatttacttcactggtctag
taaaattatacacacacacagacatgcacacacatatataaacattcaca
cacatacatatgtacaggtattgttatttgtaatttgacccttgtatttt
ttagtttaaaatgttagtactgcaaaatgttatgtcctcaaaaacacatt
gtaccatgattatgccgctttcaatattgtaaagtgaggtttttgccgca
ttattattttttggatttcaatagcatagcttcaagttattcgtaagaat
tttttataaataatacatttttatacttttttataattaccatatcatca
tagtgaagtatataatatatatgatataagctcaatatagtatattaatt
ccgttaaacacaaagacatatcagtttgtagctttggtggataaacaaat
taatttagcaattcatggctatgaaaaatgtatattttatttaaaaattt
taaagaaagctaaatgatcaaattatttaatgatgaattatatgatagac
actttatataagaaaaacttcaacagcaacaaattaaaattttttcatca
ttttctaggtggacttaaatcatatttacggtgaaactctggctagacag
cgtaaactgcgccttttcaaggatggaaaaatgaaatatcag
gtatgctt
cctttgactattaagacttagttattaccgcttatacccatattttaaaa
tccctaaaaatgtgttccttaactttttaactgatgtttatttatttatt
tatttttttagataattgatggagagatgtatcctcccacagtcaaagat
actcaggcagagatgatctaccctcctcaagtccctgagcatctacggtt
tgctgtggggcaggaggtctttggtctggtgcctggtctgatgatgtatg
ccacaatctggctgcgggaacacaacagagtatgcgatgtgcttaaacag
gagcatcctgaatggggtgatgagcagttgttccagacaagcaggctaat
actgatag
gtaaacaagaaaatgatttatataaaaccctcttccccaggg
aaaattagtgtgctatctttgttatgttttgagtaaatgacaagatgtgg
taaatgaaaactcacacattctatatacattaaatatgtaagcatgactg
ataaaatagctatcttttgatactgacaaggaagaaaacagaaatgaagg
aatagcaaattttaaaaattgcattccagttgcttgaaagcttgtgatca
gatgcaataaatgtttttattatttattttgtgcaaataggagagactat
taagattgtgattgaagattatgtgcaacacttgagtggctatcacttca
aactgaaatttgacccagaactacttttcaacaaacaattccagtaccaa
aatcgtattgctgctgaatttaacaccctctatcactggcatccccttct
gcctgacacctttcaaattcatgaccagaaatacaactatcaacagttta
tctacaacaactctatattgctggaacatggaattacccagtttgttgaa
tcattcaccaggcaaattgctggcagg
gtaagcattattattgaaaacca
aaacaaaagactagtcagtaactttagaatttctgccacggaaattattt
ttcttaaacttactaaaagagtagttagttatattgctagtaaaattatt
ttattgatataagaagcctaactttgtttgaaaagtctaaacttttagtc
tagtctacagttgtcagacaaatagcaaattgtacccctaccttaaaaat
attttcaaaaagtatctataatcttataggaataaatattttaggcttga
atactagtgttatttttgaaatgtaaaaaggcaaattagttctaggctgg
tgtcccattgaattttaagcagagctcctgttgaaatgtaggtaagcatc
tttccagcaaataaaaattgtctccgctgggagtttcagttttacctgat
ttgtacctaaggcaagctgaatacaaacagtaaatatgcctaaaattctt
gttttacaactaattttactttccacaggttgctggtggtaggaatgttc
cacccgcagtacagaaagtatcacaggcttccattgaccagagcaggcag
atgaaataccagtcttttaatgagtaccgcaaacgctttatgctgaagcc
ctatgaatcatttgaagaacttacag
gtaagaaacagtttctaaacttct
tcgttttttgtttgtttgtttgtttttgttgtttttggttttcttttcga
gatggagccgccctctgtcacccaggctggagtgcagtggcgccatctcg
gctcactgcaacctccgcctcctgggttcaagcaattctcctgcctcaac
ttcctgagtagctgggactacaggctcacgtcgcacgcatggataatttt
ttgtattttcagtatagacggggtttcaccgtgttagccaggctggtctc
aaactcctgacctagtgatccgccggcttcggcctcccgaagtgctggga
ttacaggcgtgagccaccgcgcctggcccctaaacttcttaaaagaatca
ggggtcaaatggaaacagagaagttggcagcaaattgagcaaaagaatca
aactgttttttattttgtgaagtttgacattggttgtatctctgtcttca
tcgccttcacaggagaaaaggaaatgtctgcagagttggaagcactctat
ggtgacatcgatgctgtggagctgtatcctgcccttctggtagaaaagcc
tcggccagatgccatctttggtgaaaccatggtagaagttggagcaccat
tctccttgaaaggacttatgggtaatgttatatgttctcctgcctactgg
aagccaagcacttttggtggagaagtgggttttcaaatcatcaacactgc
ctcaattcagtctctcatctgcaataacgtgaagggctgtccctttactt
cattcagtgttccagatccagagctcattaaaacagtcaccatcaatgca
agttcttcccgctccggactagatgatatcaatcccacagtactactaaa
agaacgttcgactgaactgtagaagtctaatgatcatatttatttattta
tatgaaccatgtctattaatttaattatttaataatatttatattaaact
ccttatgttacttaacatcttctgtaacagaagtcagtactcctgttgcg
gagaaaggagtcatacttgtgaagacttttatgtcactactctaaagatt
ttgctgttgctgttaagtttggaaaacagtttttattctgttttataaac
cagagagaaatgagttttgacgtctttttacttgaatttcaacttatatt
ataagaacgaaagtaaagatgtttgaatacttaaacactgtcacaagatg
gcaaaatgctgaaagtttttacactgtcgatgtttccaatgcatcttcca
tgatgcattagaagtaactaatgtttgaaattttaaagtacttttggtta
tttttctgtcatcaaacaaaaacaggtatcagtgcattattaaatgaata
tttaaattagacattaccagtaatttcatgtctactttttaaaatcagca
atgaaacaataatttgaaatttctaaattcatagggtagaatcacctgta
aaagcttgtttgatttcttaaagttattaaacttgtacatataccaaaaa
gaagctgtcttggatttaaatctgtaaaatcagtagaaattttactacaa
ttgcttgttaaaatattttataagtgatgttcctttttcaccaagagtat
aaacctttttagtgtgactgttaaaacttccttttaaatcaaaatgccaa
atttattaaggtggtggagccactgcagtgttatcttaaaataagaatat
tttgttgagatattccagaatttgtttatatggctggtaacatgtaaaat
ctatatcagcaaaagggtctacctttaaaataagcaataacaaagaagaa
aaccaaattattgttcaaatttaggtttaaacttttgaagcaaacttttt
tttatccttgtgcactgcaggcctggtactcagattttgctatgaggtta
atgaagtaccaagctgtgcttgaataatgatatgttttctcagattttct
gttgtacagtttaatttagcagtccatatcacattgcaaaagtagcaatg
acctcataaaatacctcttcaaaatgcttaaattcatttcacacattaat
tttatctcagtcttgaagccaattcagtaggtgcattggaatcaagcctg
gctacctgcatgctgttccttttcttttcttcttttagccattttgctaa
gagacacagtcttctcatcacttcgtttctcctattttgttttactagtt
ttaagatcagagttcactttctttggactctgcctatattttcttacctg
aacttttgcaagttttcaggtaaacctcagctcaggactgctatttagct
cctcttaagaagattaaaagagaaaaaaaaaggcccttttaaaaatagta
tacacttattttaagtgaaaagcagagaattttatttatagctaatttta
gctatctgtaaccaagatggatgcaaagaggctagtgcctcagagagaac
tgtacggggtttgtgactggaaaaagttacgttcccattctaattaatgc
cctttcttatttaaaaacaaaaccaaatgatatctaagtagttctcagca
ataataataatgacgataatacttcttttccacatctcattgtcactgac
atttaatggtactgtatattacttaatttattgaagattattatttatgt
cttattaggacactatggttataaactgtgtttaagcctacaatcattga
tttttttttgttatgtcacaatcagtatatcttctttggggttacctctc
tgaatattatgtaaacaatccaaagaaatgattgtattaagatttgtgaa
taaatttttagaaatctgattggcatattgagatatttaaggttgaatgt
ttgtccttaggataggcctatgtgctagcccacaaagaatattgtctcat
tagcctgaatgtgccataagactgaccttttaaaatgttttgagggatct
gtggatgcttcgttaatttgttcagccacaatttattgagaaaatattct
gtgtcaagcactgtgggttttaatatttttaaatcaaacgctgattacag
ataatagtatttatataaataattgaaaaaaattttcttttgggaagagg
gagaaaatgaaataaatatcattaaagataactcaggagaatcttcttta
caattttacgtttagaatgtttaaggttaagaaagaaatagtcaatatgc
ttgtataaaacactgttcactgttttttttaaaaaaaaaacttgatttgt
tattaacattgatctgctgacaaaacctgggaatttgggttgtgtatgcg
aatgtttcagtgcctcagacaaatgtgtatttaacttatgtaaaagataa
gtctggaaataaatgtctgtttatttttgtactatttat
aaaattgacag
atcttttctgaagataaactttgattgtttctatacatctttgtcatatg
acataagatttctctgaagcattactcttaaaccattatcttgcattctc
ctacctattcaaaactaggactggcccttcatgaaatggttttgccctca
attatatagaggcttcctagagtcactatttaaatctcataatccttatt
cactgcgacactgtgttggaaaatgtctagtttgtgtatctttacagaag
atggcaaacaagcttattttcattgcctagtctagaagaagaagaaaaaa
atacacaataaggcaaagaataagacatatattatgaagggggcacaaag
ttaagaagttcaaagaggaggaaattatacaaagttgggcaaatcattga
tgcaaaagctcataggcttttgttgtacctctatccttgacatcttggta
atttcaatatctacatggaccacatatttagcatcttccctggcctctcc
tctttggccttctccattccagggatggcctcttccaccatatttcctga
aatcatacatatcttgatatcattatgattaattacagcaccactttcaa
aatcttgattccaagcatcttccagctcacctattttattgcttacactc
taacatctaactctcagtctcactgaacctaccgatccaccaacctcatc
acttcactatttatcacctgttttatctttccatttacttccatatgcat
ctagctcagattctattgtccatcattctaatcattcccctctgctctgt
atattctccctctactgtgctgaattgacacaagttgattaaatccagcc
attctcctaatctgttttttatttggcttctcagtagcattcaacacaaa
tagctataatctctttactgaaagaacccctgccccaaccttggcttcat
ggtttgatactctcctggtctttctctacctttctcaga


On/off switch | Start codon | Stop codon | Exons | Introns | Hitchhiking code | Ancient code | Sites of variation | A gene




Watch the Program Here | Our Genetic Future (A Survey)
Manipulating Genes: How Much is Too Much? | Understanding Heredity
Explore a Stretch of Code | Nature vs Nurture Revisited
Sequence for Yourself | Journey into DNA | Meet the Decoders
Resources | Update to Program | Teacher's Guide | Transcript
Site Map | Cracking the Code of Life Home

Editor's Picks | Previous Sites | Join Us/E-mail | TV/Web Schedule | About NOVA
Watch NOVAs online | Teachers | Site Map | Shop | Search | To Print
PBS Online | NOVA Online | WGBH

© | Updated April 2001

Support provided by

For new content
visit the redesigned
NOVA site

/wgbh/nova/genome/textindex.html /wgbh/nova/genome/